Top » Catalog » SNPs » FGC64421

$18.00

FGC64421
[FGC64421]

FGC64421
hg38 Position: ChrY:13042087..13042087
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC64421_F AATGCTACCTGGGGACTGTG
Reverse Primer: FGC64421_R TCCCCAATCCCTCCCTATAC
Reviews

Customers who bought this product also purchased
A22925
A22925
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
A22924
A22924
Y154841
Y154841
HU402
HU402
A19274
A19274
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies