Top » Catalog » SNPs » FGC64421

$18.00

FGC64421
[FGC64421]

FGC64421
hg38 Position: ChrY:13042087..13042087
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC64421_F AATGCTACCTGGGGACTGTG
Reverse Primer: FGC64421_R TCCCCAATCCCTCCCTATAC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies