Top » Catalog » SNPs » FGC64421

$18.00

FGC64421
[FGC64421]

FGC64421
hg38 Position: ChrY:13042087..13042087
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC64421_F AATGCTACCTGGGGACTGTG
Reverse Primer: FGC64421_R TCCCCAATCCCTCCCTATAC
Reviews

Customers who bought this product also purchased
A22925
A22925
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
A22924
A22924
Y154841
Y154841
Wish a SNP
Wish a SNP
A19265
A19265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies