Top » Catalog » SNPs » FGC64425

$18.00

FGC64425
[FGC64425]

FGC64425
hg38 Position: ChrY:16633597..16633597
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC64425vl2_F TGAGGGAAAATACGCAGACAG
Reverse Primer: FGC64425vl2_R TGCACTGATCTTTAATTGAGCATC
Reviews

Customers who bought this product also purchased
HU403
HU403
A19275
A19275
HU408
HU408
A19280
A19280
HU397
HU397
A19266
A19266
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies