Top » Catalog » SNPs » FGC64425

$18.00

FGC64425
[FGC64425]

FGC64425
hg38 Position: ChrY:16633597..16633597
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC64425vl2_F TGAGGGAAAATACGCAGACAG
Reverse Primer: FGC64425vl2_R TGCACTGATCTTTAATTGAGCATC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A19265
A19265
HU401
HU401
A19272
A19272
HU406
HU406
A19278
A19278
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies