Top » Catalog » SNPs » A19083

$18.00

A19083
[A19083]

A19083
hg38 Position: ChrY:7389141..7389141
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19083_F ATTAGGACCCAGCAAGCAAG
Reverse Primer: A19083_R ACCATTGGACCCCTTTCAC
Reviews

Customers who bought this product also purchased
A19103
A19103
FGC21239
FGC21239
FGC21216
FGC21216
FGC21224
FGC21224
A19097
A19097
FGC21235
FGC21235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies