Top » Catalog » SNPs » A19083

$18.00

A19083
[A19083]

A19083
hg38 Position: ChrY:7389141..7389141
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19083_F ATTAGGACCCAGCAAGCAAG
Reverse Primer: A19083_R ACCATTGGACCCCTTTCAC
Reviews

Customers who bought this product also purchased
FGC21220
FGC21220
R1a-YP6375 Bures Panel
R1a-YP6375 Bures Panel
FGC21229
FGC21229
A19123
A19123
FGC21241
FGC21241
FGC21219
FGC21219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies