Top » Catalog » SNPs » A19088

$18.00

A19088
[A19088]

A19088
hg38 Position: ChrY:8196979..8196979
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19088_F CCAGTTCTGAAATTAAGGCAACG
Reverse Primer: A19088_R CTTGTTCAAGTTCGATACGACTTC
Reviews

Customers who bought this product also purchased
A19112
A19112
FGC21102
FGC21102
A19142
A19142
FGC21107
FGC21107
R1a-YP942 Voldan Panel
R1a-YP942 Voldan Panel
A19159
A19159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies