Top » Catalog » SNPs » A19088

$18.00

A19088
[A19088]

A19088
hg38 Position: ChrY:8196979..8196979
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19088_F CCAGTTCTGAAATTAAGGCAACG
Reverse Primer: A19088_R CTTGTTCAAGTTCGATACGACTTC
Reviews

Customers who bought this product also purchased
A19081
A19081
A19155
A19155
FGC21110
FGC21110
A19102
A19102
A19316
A19316
A19119
A19119
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies