Top » Catalog » SNPs » A19091

$19.00

A19091
[A19091]

A19091
hg38 Position: ChrY:9043766..9043766
Ancestral: C
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19091v2_F CATTCCTGAAGTCAGCAAGACAG
Reverse Primer: A19091v2_R CTCATGGCCACTGGGTCC
Reviews

Customers who bought this product also purchased
A19129
A19129
A19079
A19079
A19147
A19147
A19101
A19101
A19158
A19158
A19115
A19115
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies