Top » Catalog » SNPs » A19094

$18.00

A19094
[A19094]

A19094
hg38 Position: ChrY:10233024..10233024
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19094_F AAAAGAGAGTTTCAAAACAGCTCTACC
Reverse Primer: A19094_R GCTTTGAAACTCTCTTCCTGTGG
Reviews

Customers who bought this product also purchased
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
A19143
A19143
A19099
A19099
A19157
A19157
A19114
A19114
A19136
A19136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies