Top » Catalog » SNPs » A19094

$18.00

A19094
[A19094]

A19094
hg38 Position: ChrY:10233024..10233024
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19094_F AAAAGAGAGTTTCAAAACAGCTCTACC
Reverse Primer: A19094_R GCTTTGAAACTCTCTTCCTGTGG
Reviews

Customers who bought this product also purchased
A19130
A19130
A19085
A19085
A19149
A19149
A19106
A19106
A19129
A19129
A19079
A19079
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies