Top » Catalog » SNPs » A19095

$18.00

A19095
[A19095]

A19095
hg38 Position: ChrY:10623924..10623924
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19095_F CCTTTCCACCATCAGCCTC
Reverse Primer: A19095_R CAAGTGAATATTTGGTGCACTTG
Reviews

Customers who bought this product also purchased
A19123
A19123
FGC21241
FGC21241
FGC21219
FGC21219
FGC21227
FGC21227
A19117
A19117
FGC21240
FGC21240
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies