Top » Catalog » SNPs » A19103

$18.00

A19103
[A19103]

A19103
hg38 Position: ChrY:12266255..12266255
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19103_F TCCTCTCTGTTGACCCTTGG
Reverse Primer: A19103_R ACACTCACCACGAGCATCTG
Reviews

Customers who bought this product also purchased
FGC21219
FGC21219
FGC21227
FGC21227
A19117
A19117
FGC21240
FGC21240
FGC21217
FGC21217
FGC21226
FGC21226
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies