Top » Catalog » SNPs » A19103

$18.00

A19103
[A19103]

A19103
hg38 Position: ChrY:12266255..12266255
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19103_F TCCTCTCTGTTGACCCTTGG
Reverse Primer: A19103_R ACACTCACCACGAGCATCTG
Reviews

Customers who bought this product also purchased
FGC21224
FGC21224
A19095
A19095
FGC21235
FGC21235
A19311
A19311
FGC21223
FGC21223
A19083
A19083
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies