Top » Catalog » SNPs » A19103

$18.00

A19103
[A19103]

A19103
hg38 Position: ChrY:12266255..12266255
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19103_F TCCTCTCTGTTGACCCTTGG
Reverse Primer: A19103_R ACACTCACCACGAGCATCTG
Reviews

Customers who bought this product also purchased
A19083
A19083
FGC21234
FGC21234
A19137
A19137
FGC21244
FGC21244
FGC21220
FGC21220
R1a-YP6375 Bures Panel
R1a-YP6375 Bures Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies