Top » Catalog » SNPs » A19104

$18.00

A19104
[A19104]

A19104
hg38 Position: ChrY:12281153..12281153
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1017
Forward Primer: A19104_F CATGATTTGGCTCACCATTG
Reverse Primer: A19104_R TCAGCTCACTGCAACCTCTG
Reviews

Customers who bought this product also purchased
A19139
A19139
A19319
A19319
A18897
A18897
A19138
A19138
A19154
A19154
R1a-YP1017 Brtnik Panel
R1a-YP1017 Brtnik Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies