Top » Catalog » SNPs » A19105

$18.00

A19105
[A19105]

A19105
hg38 Position: ChrY:12559671..12559671
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19105_F TCAGTTAGGGCAGGAACCAG
Reverse Primer: A19105_R TATCCGGGTCATCACCAATC
Reviews

Customers who bought this product also purchased
A19093
A19093
A19315
A19315
PF2606
PF2606
A19113
A19113
FGC21103
FGC21103
A19077
A19077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies