Top » Catalog » SNPs » A19105

$15.00

A19105
[A19105]

A19105
hg38 Position: ChrY:12559671..12559671
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19105v2_F GAATTTCACAAGATAATGTCATCAGTTAG
Reverse Primer: A19105v2_R CGGAACTTGTGTCTTCTGTTTG
Reviews

Customers who bought this product also purchased
R1a-YP942 Voldan Panel
R1a-YP942 Voldan Panel
A19142
A19142
FGC21107
FGC21107
A19086
A19086
A19159
A19159
FGC21113
FGC21113
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies