Top » Catalog » SNPs » A19105

$18.00

A19105
[A19105]

A19105
hg38 Position: ChrY:12559671..12559671
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19105v2_F GAATTTCACAAGATAATGTCATCAGTTAG
Reverse Primer: A19105v2_R CGGAACTTGTGTCTTCTGTTTG
Reviews

Customers who bought this product also purchased
A19107
A19107
CTS4994
CTS4994
A19127
A19127
FGC21106
FGC21106
A19084
A19084
A19156
A19156
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies