Top » Catalog » SNPs » A19109

$18.00

A19109
[A19109]

A19109
hg38 Position: ChrY:12848376..12848376
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19109v2_F TGACATTTTAAGAATCACCATTCTG
Reverse Primer: A19109v2_R CCTAGGCAATACCATTCAGGAG
Reviews

Customers who bought this product also purchased
A19121
A19121
Y11818
Y11818
DYS644
DYS644
A19116
A19116
A19309
A19309
DYF371X
DYF371X
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies