Top » Catalog » SNPs » A19109

$18.00

A19109
[A19109]

A19109
hg38 Position: ChrY:12848376..12848376
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19109_F TGGTTTTGATTTACATTTCTCTAATCATC
Reverse Primer: A19109_R GATCCCTTCCTTACACCTTATACAAAG
Reviews

Customers who bought this product also purchased
Y11818
Y11818
DYF371X
DYF371X
DYF399X
DYF399X
A19309
A19309
FTDNA111 to YSEQ116
FTDNA111 to YSEQ116
DYS464X
DYS464X
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies