Top » Catalog » SNPs » A19109

$18.00

A19109
[A19109]

A19109
hg38 Position: ChrY:12848376..12848376
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19109_F TGGTTTTGATTTACATTTCTCTAATCATC
Reverse Primer: A19109_R GATCCCTTCCTTACACCTTATACAAAG
Reviews

Customers who bought this product also purchased
FTDNA111 to YSEQ116
FTDNA111 to YSEQ116
DYS464X
DYS464X
A19134
A19134
YSEQ-XTD
YSEQ-XTD
DYS684
DYS684
A19128
A19128
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies