Top » Catalog » SNPs » A19110

$18.00

A19110
[A19110]

A19110
hg38 Position: ChrY:12990511..12990511
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: T1a
Comments: PF4074
Forward Primer: A19110_F GAGTTGCTCTTCTCGAGGAGTC
Reverse Primer: A19110_R CTTTGAAAAAAAAATTAGAGGAAAGGC
Reviews

Customers who bought this product also purchased
A19078
A19078
BY2099
BY2099
A19076
A19076
A19146
A19146
A18899
A18899
A19144
A19144
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies