Top » Catalog » SNPs » A19110

$18.00

A19110
[A19110]

A19110
hg38 Position: ChrY:12990511..12990511
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: T1a
Comments: PF4074
Forward Primer: A19110_F GAGTTGCTCTTCTCGAGGAGTC
Reverse Primer: A19110_R CTTTGAAAAAAAAATTAGAGGAAAGGC
Reviews

Customers who bought this product also purchased
Y22931
Y22931
T-PF4074 Berger Panel
T-PF4074 Berger Panel
A19089
A19089
M8325
M8325
A19078
A19078
BY2099
BY2099
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies