Top » Catalog » SNPs » A19111

$18.00

A19111
[A19111]

A19111
hg38 Position: ChrY:13021269..13021269
Ancestral: G
Derived: C
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19111_F TCTTTGTGGCTGTTGCAATG
Reverse Primer: A19111_R ACAGAAGCCGGAACCATTC
Reviews

Customers who bought this product also purchased
A19092
A19092
A19151
A19151
A19108
A19108
A19135
A19135
A19091
A19091
A19150
A19150
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies