Top » Catalog » SNPs » A19114

$18.00

A19114
[A19114]

A19114
hg38 Position: ChrY:13787245..13787245
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2b
Comments: Y12007
Forward Primer: A19114_F CTCCCACAGGGTCCTTCC
Reverse Primer: A19114_R AATATCACTAATGCAGCAATATACCTTGAC
Reviews

Customers who bought this product also purchased
A19079
A19079
A19147
A19147
A19099
A19099
A19158
A19158
A19115
A19115
J2-Y12007 Autrata Panel
J2-Y12007 Autrata Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies