Top » Catalog » SNPs » A19116

$18.00

A19116
[A19116]

A19116
hg38 Position: ChrY:13909908..13909908
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19116_F GAAGTCTCACTGATTGCTAGCG
Reverse Primer: A19116_R TCAGGGGAGTACCCAGCTG
Reviews

Customers who bought this product also purchased
DYF399X
DYF399X
A19134
A19134
FTDNA111 to YSEQ116
FTDNA111 to YSEQ116
DYS464X
DYS464X
A19128
A19128
YSEQ-XTD
YSEQ-XTD
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies