Top » Catalog » SNPs » A19116

$18.00

A19116
[A19116]

A19116
hg38 Position: ChrY:13909908..13909908
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19116v12_F GAAGTCTCACTGATTGCTAGCG
Reverse Primer: A19116v12_R AGGTCTGTTGGAGTTGGCTG
Reviews

Customers who bought this product also purchased
R1a-YP1341 Cepela Panel
R1a-YP1341 Cepela Panel
DYS614
DYS614
A19121
A19121
Y11818
Y11818
DYS644
DYS644
A19109
A19109
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies