Top » Catalog » SNPs » A19116

$18.00

A19116
[A19116]

A19116
hg38 Position: ChrY:13909908..13909908
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19116v12_F GAAGTCTCACTGATTGCTAGCG
Reverse Primer: A19116v12_R AGGTCTGTTGGAGTTGGCTG
Reviews

Customers who bought this product also purchased
DYS644
DYS644
A19109
A19109
A19309
A19309
DYF371X
DYF371X
DYF399X
DYF399X
A19134
A19134
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies