Top » Catalog » SNPs » A19117

$18.00

A19117
[A19117]

A19117
hg38 Position: ChrY:14133469..14133469
Ancestral: A
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19117_F TTGCCCCAGACACTTTTAGC
Reverse Primer: A19117_R TCAATTGCAAGAGGCTTTCC
Reviews

Customers who bought this product also purchased
A19123
A19123
FGC21241
FGC21241
FGC21219
FGC21219
FGC21227
FGC21227
A19103
A19103
FGC21240
FGC21240
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies