Top » Catalog » SNPs » A19118

$15.00

A19118
[A19118]

A19118
hg38 Position: ChrY:14346557..14346557
Ancestral: A
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: J2a
Comments: FGC21085
Forward Primer: A19118_F TATAGCCTGGAAGCCCCATC
Reverse Primer: A19118_R AAATCCATGCATGTTCAACG
Reviews

Customers who bought this product also purchased
FGC21094
FGC21094
J2-BY268-Kessler Panel
J2-BY268-Kessler Panel
FGC21080
FGC21080
FGC21092
FGC21092
FGC21079
FGC21079
FGC21090
FGC21090
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies