Top » Catalog » SNPs » A19120

$18.00

A19120
[A19120]

A19120
hg38 Position: ChrY:14536342..14536342
Ancestral: G
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1017
Forward Primer: A19120_F TGGTGAACACATTTTCCTGAAG
Reverse Primer: A19120_R ACAGGAATGAGGCACTCCAC
Reviews

Customers who bought this product also purchased
A19320
A19320
A19082
A19082
A19139
A19139
A19319
A19319
A18897
A18897
A19138
A19138
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies