Top » Catalog » SNPs » A19121

$18.00

A19121
[A19121]

A19121
hg38 Position: ChrY:14613471..14613471
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19121_F CTCCGAGAGGGTGAGATCAG
Reverse Primer: A19121_R AATGAGATCATTTGGGCACAG
Reviews

Customers who bought this product also purchased
DYF399X
DYF399X
A19309
A19309
FTDNA111 to YSEQ116
FTDNA111 to YSEQ116
DYS464X
DYS464X
A19134
A19134
YSEQ-XTD
YSEQ-XTD
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x YSEQ-Gamma
1 x YSEQ-Beta
1 x mtComplete
1 x HVR2
1 x HVR1
1 x mtUpgrade
$483.00
Haplogroup Info
Other products
Currencies