Top » Catalog » SNPs » A19121

$18.00

A19121
[A19121]

A19121
hg38 Position: ChrY:14613471..14613471
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19121_F CTCCGAGAGGGTGAGATCAG
Reverse Primer: A19121_R AATGAGATCATTTGGGCACAG
Reviews

Customers who bought this product also purchased
DYS614
DYS614
A19116
A19116
Y11818
Y11818
DYS644
DYS644
A19109
A19109
A19309
A19309
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies