Top » Catalog » SNPs » A19121

$18.00

A19121
[A19121]

A19121
hg38 Position: ChrY:14613471..14613471
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19121_F CTCCGAGAGGGTGAGATCAG
Reverse Primer: A19121_R AATGAGATCATTTGGGCACAG
Reviews

Customers who bought this product also purchased
A19134
A19134
YSEQ-XTD
YSEQ-XTD
DYS684
DYS684
A19128
A19128
R1a-YP1341 Cepela Panel
R1a-YP1341 Cepela Panel
DYS614
DYS614
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies