Top » Catalog » SNPs » A19123

$18.00

A19123
[A19123]

A19123
hg38 Position: ChrY:15426633..15426633
Ancestral: G
Derived: C
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19123_F AAGAAAAGGTGCACCAGGAG
Reverse Primer: A19123_R GTTAGGCTGCTCAGGGTCAG
Reviews

Customers who bought this product also purchased
FGC21216
FGC21216
FGC21224
FGC21224
A19095
A19095
FGC21235
FGC21235
A19311
A19311
FGC21223
FGC21223
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies