Top » Catalog » SNPs » A19125

$18.00

A19125
[A19125]

A19125
hg38 Position: ChrY:15514725..15514725
Ancestral: C
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1017
Forward Primer: A19125_F ACCCCACAATAGGATTTAGTTAACCTC
Reverse Primer: A19125_R GAAAGTTACCCAAAGCTTGCATC
Reviews

Customers who bought this product also purchased
A19133
A19133
A19145
A19145
A19120
A19120
A19141
A19141
A19321
A19321
A19104
A19104
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies