Top » Catalog » SNPs » A19128

$18.00

A19128
[A19128]

A19128
hg38 Position: ChrY:15671659..15671659
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19128_F TTTGCTATTGTGAAAAGTGCTGC
Reverse Primer: A19128_R CTAGTATTCCTGATGAACAGAATATACAAATAAC
Reviews

Customers who bought this product also purchased
A19109
A19109
A19309
A19309
DYF371X
DYF371X
DYF399X
DYF399X
A19134
A19134
FTDNA111 to YSEQ116
FTDNA111 to YSEQ116
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies