Top » Catalog » SNPs » A19128

$18.00

A19128
[A19128]

A19128
hg38 Position: ChrY:15671659..15671659
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19128_F TTTGCTATTGTGAAAAGTGCTGC
Reverse Primer: A19128_R CTAGTATTCCTGATGAACAGAATATACAAATAAC
Reviews

Customers who bought this product also purchased
A19124
A19124
R1a-YP1341 Cepela Panel
R1a-YP1341 Cepela Panel
DYS614
DYS614
A19121
A19121
DYS644
DYS644
A19109
A19109
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies