Top » Catalog » SNPs » A19133

$18.00

A19133
[A19133]

A19133
hg38 Position: ChrY:16641396..16641396
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1017
Forward Primer: A19133v2_F CTGGGGGTCTTGAGCCAC
Reverse Primer: A19133v2_R AGGAATACAGGTTCATCTCAGACC
Reviews

Customers who bought this product also purchased
A18897
A18897
A19138
A19138
A19154
A19154
R1a-YP1017 Brtnik Panel
R1a-YP1017 Brtnik Panel
A19125
A19125
A19145
A19145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies