Top » Catalog » SNPs » A19133

$18.00

A19133
[A19133]

A19133
hg38 Position: ChrY:16641396..16641396
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1017
Forward Primer: A19133v2_F CTGGGGGTCTTGAGCCAC
Reverse Primer: A19133v2_R AGGAATACAGGTTCATCTCAGACC
Reviews

Customers who bought this product also purchased
A19125
A19125
A19145
A19145
A19120
A19120
A19141
A19141
A19321
A19321
A19104
A19104
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies