Top » Catalog » SNPs » A19144

$18.00

A19144
[A19144]

A19144
hg38 Position: ChrY:19803227..19803227
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: T1a
Comments: PF4074
Forward Primer: A19144_F TGAAAGTGACGAGGAGAATGG
Reverse Primer: A19144_R GCCTAGTTTGGCTGGGTATG
Reviews

Customers who bought this product also purchased
Z19867
Z19867
A18898
A18898
A19090
A19090
Y22931
Y22931
T-PF4074 Berger Panel
T-PF4074 Berger Panel
A19089
A19089
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies