Top » Catalog » SNPs » A19144

$18.00

A19144
[A19144]

A19144
hg38 Position: ChrY:19803227..19803227
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: T1a
Comments: PF4074
Forward Primer: A19144_F TGAAAGTGACGAGGAGAATGG
Reverse Primer: A19144_R GCCTAGTTTGGCTGGGTATG
Reviews

Customers who bought this product also purchased
A19089
A19089
M8325
M8325
A19078
A19078
BY2099
BY2099
A19076
A19076
A19146
A19146
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies