Top » Catalog » SNPs » A19134

$18.00

A19134
[A19134]

A19134
hg38 Position: ChrY:16762851..16762851
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19134_F TAGTGGTTCTCCCAGTATGGAGTTC
Reverse Primer: A19134_R CTTTGGGGGAGAAGAGGC
Reviews

Customers who bought this product also purchased
A19109
A19109
Y11818
Y11818
DYF371X
DYF371X
DYF399X
DYF399X
A19309
A19309
FTDNA111 to YSEQ116
FTDNA111 to YSEQ116
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies