Top » Catalog » SNPs » A19134

$18.00

A19134
[A19134]

A19134
hg38 Position: ChrY:16762851..16762851
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1341
Forward Primer: A19134_F TAGTGGTTCTCCCAGTATGGAGTTC
Reverse Primer: A19134_R CTTTGGGGGAGAAGAGGC
Reviews

Customers who bought this product also purchased
DYF399X
DYF399X
A19309
A19309
FTDNA111 to YSEQ116
FTDNA111 to YSEQ116
DYS464X
DYS464X
A19128
A19128
YSEQ-XTD
YSEQ-XTD
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies