Top » Catalog » SNPs » A19138

$18.00

A19138
[A19138]

A19138
hg38 Position: ChrY:19049778..19049778
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1017
Forward Primer: A19138_F GGTGACAGGGCAAGACTCTC
Reverse Primer: A19138_R TGAAAGGCTCCAAGTCAAGC
Reviews

Customers who bought this product also purchased
A19319
A19319
A18897
A18897
A19133
A19133
A19154
A19154
R1a-YP1017 Brtnik Panel
R1a-YP1017 Brtnik Panel
A19125
A19125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies