Top » Catalog » SNPs » A19138

$18.00

A19138
[A19138]

A19138
hg38 Position: ChrY:19049778..19049778
Ancestral: C
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1017
Forward Primer: A19138_F GGTGACAGGGCAAGACTCTC
Reverse Primer: A19138_R TGAAAGGCTCCAAGTCAAGC
Reviews

Customers who bought this product also purchased
A19321
A19321
A19104
A19104
A19140
A19140
A19320
A19320
A19082
A19082
A19139
A19139
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies