Top » Catalog » SNPs » A19140

$18.00

A19140
[A19140]

A19140
hg38 Position: ChrY:19190285..19190285
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP1017
Forward Primer: A19140_F TTGTTCCATTGCTGTTGAGG
Reverse Primer: A19140_R ACCCCCAAGTAGGGACAGAC
Reviews

Customers who bought this product also purchased
A19154
A19154
R1a-YP1017 Brtnik Panel
R1a-YP1017 Brtnik Panel
A19125
A19125
A19145
A19145
A19120
A19120
A19141
A19141
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies