Top » Catalog » SNPs » A927

$18.00

A927
[A927]

A927
hg38 Position: ChrY:14354820..14354820
Ancestral: C
Derived: A
Reference: Ramelet-Stuart (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A927_F TCCAGGAGGAAATCAATTCTG
Reverse Primer: A927_R CCAACAAGGACAGGTGAGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies