Top » Catalog » SNPs » A19153

$18.00

A19153
[A19153]

A19153
hg38 Position: ChrY:20920334..20920334
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19153_F GCAAAACCTGCCTCCCAG
Reverse Primer: A19153_R TTGTGGAAGTCAGTGTAGCGAC
Reviews

Customers who bought this product also purchased
A19080
A19080
A19152
A19152
FGC21109
FGC21109
A19093
A19093
A19315
A19315
PF2606
PF2606
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies