Top » Catalog » SNPs » A19127

$18.00

A19127
[A19127]

A19127
hg38 Position: ChrY:15662947..15662947
Ancestral: T
Derived: C
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19127_F TTGTGGGATATAAGTGCTGAATG
Reverse Primer: A19127_R TGCCAATCAGCGATAAACTG
Reviews

Customers who bought this product also purchased
FGC21102
FGC21102
A19107
A19107
FGC21107
FGC21107
R1a-YP942 Voldan Panel
R1a-YP942 Voldan Panel
A19142
A19142
FGC21113
FGC21113
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies