Top » Catalog » SNPs » FGC2571

$18.00

FGC2571
[FGC2571]

FGC2571
hg38 Position: ChrY:11740244..11740244
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2571_F GGATTGCAATGTGACTGATTTG
Reverse Primer: FGC2571_R CCATTTGATGTATTCCCGAGTC
Reviews

Customers who bought this product also purchased
FGC2589
FGC2589
FGC2573
FGC2573
FGC2585
FGC2585
R1a-FGC2555 Hollister Panel
R1a-FGC2555 Hollister Panel
FGC2582
FGC2582
FGC2581
FGC2581
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies