Top » Catalog » SNPs » FGC2574

$18.00

FGC2574
[FGC2574]

FGC2574
hg38 Position: ChrY:12141515..12141515
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2574_F ATGGAGGCAGAGGTGAAGAG
Reverse Primer: FGC2574_R AGGTCCATTTTTGCTGCTTG
Reviews

Customers who bought this product also purchased
FGC2590
FGC2590
FGC2573
FGC2573
FGC2589
FGC2589
FGC2571
FGC2571
FGC2585
FGC2585
R1a-FGC2555 Hollister Panel
R1a-FGC2555 Hollister Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies