Top » Catalog » SNPs » FGC2578

$18.00

FGC2578
[FGC2578]

FGC2578
hg38 Position: ChrY:13160875..13160875
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2578_F TCTTCTCATGCCGGTTTTTC
Reverse Primer: FGC2578_R TGTGCCCTATCACAGTCTCC
Reviews

Customers who bought this product also purchased
R1a-FGC2555 Hollister Panel
R1a-FGC2555 Hollister Panel
FGC2582
FGC2582
FGC2581
FGC2581
FGC2591
FGC2591
FGC2574
FGC2574
FGC2590
FGC2590
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies