Top » Catalog » SNPs » FGC2578

$18.00

FGC2578
[FGC2578]

FGC2578
hg38 Position: ChrY:13160875..13160875
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2578_F TCTTCTCATGCCGGTTTTTC
Reverse Primer: FGC2578_R TGTGCCCTATCACAGTCTCC
Reviews

Customers who bought this product also purchased
FGC2582
FGC2582
FGC2581
FGC2581
FGC2591
FGC2591
FGC2574
FGC2574
FGC2590
FGC2590
FGC2573
FGC2573
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies