Top » Catalog » SNPs » FGC2581

$18.00

FGC2581
[FGC2581]

FGC2581
hg38 Position: ChrY:14847222..14847222
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2581_F ACCTGGAACCACATTTGTCC
Reverse Primer: FGC2581_R TCTGGCTGCTAGAATTAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies