Top » Catalog » SNPs » FGC2582

$18.00

FGC2582
[FGC2582]

FGC2582
hg38 Position: ChrY:14877002..14877002
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2582_F TTTCAGCTTCAAATGATGCAC
Reverse Primer: FGC2582_R CCATTTTAGCCATGCTGGTC
Reviews

Customers who bought this product also purchased
FGC2581
FGC2581
FGC2578
FGC2578
FGC2591
FGC2591
FGC2574
FGC2574
FGC2590
FGC2590
FGC2573
FGC2573
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies